WormBase Tree Display for Construct: WBCnstr00020417
expand all nodes | collapse all nodes | view schema
WBCnstr00020417 | Summary | [prsp-6::GFP] | |
---|---|---|---|
Driven_by_gene | WBGene00004703 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [prsp-6::GFP] transcriptional fusion. Presumptive promoter regions were PCR-amplified and subcloned into the pDONR221 vector using Gateway BP Clonase II (Invitrogen). Promoters were then subcloned into pDJK237, a promoterless plasmid with a Gateway cassette upstream of GFP with a 3' UTR from let-858 derived from pPD117.01, using Gateway LR Clonase II Plus (Invitrogen). attB1 - gtgtaaatgtgatgcattcgag attB2 - actgaaaaatcaaattaatttatg. | ||
Used_for | Transgene_construct | WBTransgene00031772 | |
Reference | WBPaper00046432 |