WormBase Tree Display for Construct: WBCnstr00019482
expand all nodes | collapse all nodes | view schema
WBCnstr00019482 | Public_name | bGG836 |
---|---|---|
Summary | [grp-1(+)] | |
Gene | WBGene00001743 | |
Construction_summary | To construct a plasmid (bGG836) containing the grp-1 genomic region [grp-1(+)], we used primers grp-1A [catcggttctggaaagcttatt] and grp-1B [ggttcaacaccttgcaaaaa] to amplify a 3.6 kb fragment of the genomic region spanning from the end of the gene upstream of grp-1 to the beginning of the immediate downstream gene. The PCR product was TOPO cloned to yield plasmid bGG836. | |
Reference | WBPaper00045516 |