Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00019482

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00019482Public_namebGG836
Summary[grp-1(+)]
GeneWBGene00001743
Construction_summaryTo construct a plasmid (bGG836) containing the grp-1 genomic region [grp-1(+)], we used primers grp-1A [catcggttctggaaagcttatt] and grp-1B [ggttcaacaccttgcaaaaa] to amplify a 3.6 kb fragment of the genomic region spanning from the end of the gene upstream of grp-1 to the beginning of the immediate downstream gene. The PCR product was TOPO cloned to yield plasmid bGG836.
ReferenceWBPaper00045516