WormBase Tree Display for Construct: WBCnstr00019246
expand all nodes | collapse all nodes | view schema
WBCnstr00019246 | Summary | [sod-3::DsRed] | |
---|---|---|---|
Gene | WBGene00004932 | ||
Fusion_reporter | DsRed | ||
Construction_summary | A genomic DNA fragment of the sod-3 gene was amplified via PCR using the following primers: TGCAAAACGAGCAGGAAAGTCA and AGTGGTACCATTCCTTCCAAAG. The latter primer contained a wobble to insert a KpnI restriction site. The fragment contained 1,146 bp of the sod-3 gene (524 bp without introns) and 1,078 bp of the 5' region including the predicted SKN-1 and DAF-16 binding sites. The fragment was cloned after PstI/KpnI digestion into the DsRed containing vector pPromrp2-3.8, which was also cut by PstI and KpnI. | ||
Used_for | Transgene_construct | WBTransgene00019918 | |
Reference | WBPaper00031033 |