Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00019246

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00019246Summary[sod-3::DsRed]
GeneWBGene00004932
Fusion_reporterDsRed
Construction_summaryA genomic DNA fragment of the sod-3 gene was amplified via PCR using the following primers: TGCAAAACGAGCAGGAAAGTCA and AGTGGTACCATTCCTTCCAAAG. The latter primer contained a wobble to insert a KpnI restriction site. The fragment contained 1,146 bp of the sod-3 gene (524 bp without introns) and 1,078 bp of the 5' region including the predicted SKN-1 and DAF-16 binding sites. The fragment was cloned after PstI/KpnI digestion into the DsRed containing vector pPromrp2-3.8, which was also cut by PstI and KpnI.
Used_forTransgene_constructWBTransgene00019918
ReferenceWBPaper00031033