WormBase Tree Display for Construct: WBCnstr00019073
expand all nodes | collapse all nodes | view schema
| WBCnstr00019073 | Other_name | Expr11587_Ex | |
|---|---|---|---|
| Summary | [K08D12.3::VENUS] | ||
| Driven_by_gene | WBGene00019537 | ||
| Fusion_reporter | Venus | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [K08D12.3::VENUS] transcriptional fusion. A 585 bp stretch upstream of the TlSS was cloned behind a VENUS reporter. To generate the K08D12.3::VENUS plasmid, ceh-22b WRE was replaced by a 585 bp region spanning the TlSS and sequence upstream of the K08D12.3 gene. PCR based cloning was used to insert this fragment at the SphI and SmaI site of the ceh-22b::VENUS plasmid. The fragment was amplified using the reverse primer 5'GCCAATCCCGGGGATCCTTTCTGTCCGAGATTACTGCAA3' with the start codon mutated and forward primer 5'TCGAAGCATGCCTGCAGCCGATTGCCGGAATGGCTTTGCGC3'. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031551 | |
| Reference | WBPaper00044833 |
