WormBase Tree Display for Construct: WBCnstr00018174
expand all nodes | collapse all nodes | view schema
WBCnstr00018174 | Other_name | Expr11126_Ex | |
---|---|---|---|
Summary | [R09B5.11::GFP] | ||
Driven_by_gene | WBGene00019979 | ||
Gene | WBGene00019979 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Translational_fusion | ||
Construction_summary | The R09B5.11 promoter sequence was amplified from the C.elegans genomic DNA with the primer set R09up-5sph (5'CATGCATGCTTCCGGACTAGCTAGCATAC3') and R09up-3 (5'CTATCATTTTTATTTTGACTGGCAAC3'), and the full-length cDNA sequence was amplified from the pCR-R09 plasmid with the primer set R09-5utr (5'CAAAGGCTAGACATTCTATAC3') and R09cdna-3sma (5'GGGTGAACATATCCGTTTTCTCATG3'). These amplicons were used as the templates for overlap extension PCR amplification of the DNA fragment containing both the promoter and cDNA by the primer set R09up-5sph and R09cdna-3sma. This amplicon and the pPD95.79 vector were digested with SphI and SmaI and were then ligated to form the C. elegans expression plasmid of R09B5.11 (pPD-R09g). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00018813 | |
Reference | WBPaper00042558 |