WormBase Tree Display for Construct: WBCnstr00014997
expand all nodes | collapse all nodes | view schema
WBCnstr00014997 | Other_name | Expr10000_Ex | |
---|---|---|---|
Summary | [acs-1(full)::GFP] | ||
Driven_by_gene | WBGene00018488 | ||
Gene | WBGene00018488 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Translational_fusion | ||
Construction_summary | [acs-1(full)::GFP] translational fusion. The acs-1(full)::GFP construct was made by PCR amplification using the following primers; forward, cataattactattgcgtcacatg; reverse, aagctcggagaaatgagag so that the coding region ended at the last codon before the stop-codon, and this was translationally fused with GFP. | ||
Used_for | Transgene_construct | WBTransgene00031330 | |
Reference | WBPaper00040893 |