WormBase Tree Display for Construct: WBCnstr00014429
expand all nodes | collapse all nodes | view schema
WBCnstr00014429 | Summary | [Punc-4c::mbl-1 genomic exons 3-8] | |
---|---|---|---|
Driven_by_gene | WBGene00006744 | ||
Gene | WBGene00019347 | ||
Construction_summary | Constructs were constructed by using the primers 5'CAAGGGGGCGCGCCATGTTCGACGAAAACAGTAATGCCG 3' and 5'GGTACCCTAGAATGGTGGTGGCTGCATGTA 3' to amplify a 6.6kb fragmentcalled 'mbl-1 genomic exons 3-8'. This fragment was inserted into a plasmid carrying the appropriate promoter using AscI and KpnI restriction sites. | ||
Used_for | Transgene_construct | WBTransgene00014820 | |
Reference | WBPaper00040749 |