Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00014429

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00014429Summary[Punc-4c::mbl-1 genomic exons 3-8]
Driven_by_geneWBGene00006744
GeneWBGene00019347
Construction_summaryConstructs were constructed by using the primers 5'CAAGGGGGCGCGCCATGTTCGACGAAAACAGTAATGCCG 3' and 5'GGTACCCTAGAATGGTGGTGGCTGCATGTA 3' to amplify a 6.6kb fragmentcalled 'mbl-1 genomic exons 3-8'. This fragment was inserted into a plasmid carrying the appropriate promoter using AscI and KpnI restriction sites.
Used_forTransgene_constructWBTransgene00014820
ReferenceWBPaper00040749