WormBase Tree Display for Construct: WBCnstr00014286
expand all nodes | collapse all nodes | view schema
| WBCnstr00014286 | Public_name | fUL#JW57 | |
|---|---|---|---|
| Other_name | Expr9766_Ex | ||
| Summary | [T09A12.4::GFP; pRF4] | ||
| Driven_by_gene | WBGene00003656 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#JW57. The reporter gene fusion assayed was made by recombineering WRM0634bB10. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: gctaccaagatgatgatatgcctcctgttctcgaaaaaaactgtgatctt, catatgactagaaaaggggttcaatcacaaaaagagatacacaggctcta. gfp was inserted directly upstream of the nhr-66 stop codon. Other strain: UL3207. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031211 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
