WormBase Tree Display for Construct: WBCnstr00011692
expand all nodes | collapse all nodes | view schema
| WBCnstr00011692 | Other_name | Expr3850_Ex | |
|---|---|---|---|
| Summary | [bli-5::gfp] | ||
| Driven_by_gene | WBGene00000255 | ||
| Gene | WBGene00000255 | ||
| Fusion_reporter | GFP | ||
| LacZ | |||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [bli-5::gfp] translational fusion. The putative promoter region incorporating the first two exons of bli-5 was `translationally' fused to LacZ, and was co-transformed with an unc-76 rescue plasmid into DR96 nematodes. Rescued transformants were selected, maintained and stained with betya-galacotosidase to examine the spatial expression of the bli-5 transcript. A 2310 bp genomic insert encompassing the putative promoter to the second exon of F45G2.5 was generated by PCR using the following primer pair; RescueF gcgctgcagctgtacctcgagacgtgggcg, and PromoR, gcgggatccgtcaggcatttctggagttatg. The insert was digested with Pst I and Bam HI and cloned into the reporter vector pPD96:04 (Addgene), then injected into DR96 worms at 5 ng/ml together with the unc-76 rescue plasmid at 100 ng/ml. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00028908 | |
| Reference | WBPaper00027125 |
