WormBase Tree Display for Construct: WBCnstr00011608
expand all nodes | collapse all nodes | view schema
WBCnstr00011608 | Other_name | Expr3697_Ex | |
---|---|---|---|
Summary | [xrn-2::gfp-PEST] | ||
Driven_by_gene | WBGene00006964 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [xrn-2::gfp-PEST] transcriptional fusion. For each gene, primers U1 and FL were used to amplify N2 genomic DNA corresponding to the initiation codon and upstream sequence, while primers FU and CAW31 (5$(B!l(B- GCCGCATAGTTAAGCCAGCC 3$(B!l(B) were used to amplify DNA corresponding to the gfp-pest or gfp gene and the 3$(B!l(B UTR of unc-54 from, respectively, pAF207 or pPD95_81. The PCR products were annealed and the resulting polynucleotide amplified using primers U2 and CAW32 (5$(B!l(B CCGCTTACAGACAAG CTGTGA 3$(B!l(B) | ||
Used_for | Transgene_construct | WBTransgene00028825 | |
Reference | WBPaper00026763 |