WormBase Tree Display for Construct: WBCnstr00011122
expand all nodes | collapse all nodes | view schema
| WBCnstr00011122 | Other_name | Expr3083_Ex | |
|---|---|---|---|
| Summary | [unc-89::gfp] | ||
| Driven_by_gene | WBGene00006820 | ||
| Gene | WBGene00006820 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [unc-89::gfp] translational fusion constructs.|To determine the expression pattern of unc-89-A and unc-89-B, a plasmid called 89regtwo colonsGFP was constructed in which a 3678 bp genomic fragment, produced by PCR (using primers GCACAAGCTTTTGAAACTACTTGTATCTGAACTAGAGC and GTACGGATCCACTGTAGTTGACATCTTCGGTTGCAG was fused in-frame to GFP within the promoterless GFP vector pPD95.77 using HindIII and BamHI sites. This genomic sequence included 2763 bp upstream of the 5 end of the originally-described unc-89 transcript,2 5UTR, first exon, first intron, and part of the second exon, encoding a total of 27 amino acid residues. --precise ends.|To determine the expression pattern of unc-89-D, a plasmid called Dregtwo colonsGFP was made in which 2681 bp of genomic sequence, generated by PCR using primers GCACAAGCTTTCAGCTGAAGGCGACTACAATGACG and GTACGGATCCTTCACAGTCCTCTACCAATCTAAACAT was fused in-frame to GFP within pPD95.77 using HindIII and BamHI sites. This genomic sequence included 2547 bp upstream of the 5 end of the unc-89-D transcript as determined by 5RACE, and nearly the entire first exon including the 105 bp 5UTR and the N-terminal nine amino acid residues of UNC-89-D. The 5 end of this sequence tested for unc-89-D promoter activity lies 1664 bp upstream of the 5 end of the sequence tested for unc-89-C promoter activity. --precise ends.|To determine the expression pattern of unc-89-C, a plasmid called 4.8regtwo colonsGFP was created in which 2279 bp of genomic sequence, produced by PCR using primers GCACAAGCTTGGCATTGGTGGTGTTTGATAAGTGG and GTACGGATCCGTGCGCAAGGCTTGAGAGGCCGTC was fused in-frame to GFP within pPD95.77 using HindIII and BamHI sites. This genomic sequence included 1823 bp upstream of the 5 end of the unc-89-C transcript as determined by 5RACE, 5UTR, first exon, first intron, and part of the second exon, encoding the N-terminal 21 amino acid residues of UNC-89-C. --precise ends. | ||
| Clone | pPD95.77 | ||
| Used_for | Transgene_construct | WBTransgene00028344 | |
| Reference | WBPaper00024436 |
