WormBase Tree Display for Construct: WBCnstr00010401
expand all nodes | collapse all nodes | view schema
| WBCnstr00010401 | Other_name | Expr1708_Ex | |
|---|---|---|---|
| Summary | [nlp-14::gfp] | ||
| Driven_by_gene | WBGene00003752 | ||
| Fusion_reporter | GFP | ||
| Construction_summary | [nlp-14::gfp] promoter fusion. The putative regulatory region was amplified by PCR (reaction 1). The gfp coding regions from pPD95.67 were amplified by using a nlp-gene specific primer that also contained GFP vector 5' sequence and by using a 3' GFP vector primer (GFP-C, AAGGGCCCGTACGGCCGACTAGTAGG) in an independent PCR (reaction 2). The two amplified products contained a 20- to 30-bp region of overlap, enabling amplification (reaction 3) of the full-length nlp::gfp fragment (template DNA from reactions 1 and 2) by using a primer from the nlp promoter and from the GFP vector (GFP-2C, GGAAACAGTTATGTTTGGTATATTGGG). --precise ends. | ||
| Clone | pPD95.67 | ||
| Used_for | Transgene_construct | WBTransgene00027638 | |
| Reference | WBPaper00004975 |
