WormBase Tree Display for Construct: WBCnstr00006709
expand all nodes | collapse all nodes | view schema
| WBCnstr00006709 | Summary | [Pmyo-3::LIN-17::GFP; unc-119(+); Pmyo-2::DsRed] | |
|---|---|---|---|
| Driven_by_gene | WBGene00003514 | ||
| WBGene00003515 | |||
| Gene | WBGene00003006 | ||
| Fusion_reporter | DsRed | ||
| GFP | |||
| Construction_summary | This transgene contains a Pmyo-3::LIN- 17::GFP plasmid that was made by amplifying the N-terminal-encoding portion of lin-17 from PSH22 (forward primer, TCCATCTAGAGGCTCCTTCTCCAAAATGATGCATTCTTTGGGC; reverse primer, GCACAATGCGACTTGGGATCGTGTGG). The lin-17 C-terminal-encoding portion was amplified from cDNA (forward primer, CCAAGCCAACCGGGTGCCCCAG; reverse primer, TCTTCCGGAACGACCTTACTGGGTCTCCATGAATTCTG). The C-terminal-encoding portion was cleaved by BamHI and BspEI and transferred into Fire vector L4817 (Pmyo- 3) that had been cleaved by AgeI and BamHI. The N-terminal-encoding portion was then cleaved by XbaI (cuts twice) and BamHI. The XbaI-BamHI fragment was transferred in first, followed by the XbaI-XbaI fragment. | ||
| Used_for | Transgene_construct | WBTransgene00006872 | |
| Interactor | WBInteraction000500495 | ||
| WBInteraction000500496 | |||
| Reference | WBPaper00031110 |
