WormBase Tree Display for Construct: WBCnstr00005136
expand all nodes | collapse all nodes | view schema
WBCnstr00005136 | Summary | [flp-2p::GFP] | |
---|---|---|---|
Driven_by_gene | WBGene00001445 | ||
Fusion_reporter | GFP | ||
Construction_summary | C. elegans genomic DNA was used as template. Primers used are: FLP55(TTGCGTGGTTTGCGACAATTGG) and FLP109(CTGTGTTCACTCTACCAGG). PCR products were digested with BamHI/EcoRV, inserted into vector pCR2.1 that was digested with BamHI/SmaI. --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00005159 | |
Reference | WBPaper00024197 |