WormBase Tree Display for Construct: WBCnstr00005126
expand all nodes | collapse all nodes | view schema
WBCnstr00005126 | Summary | [flp-11p::GFP] | |
---|---|---|---|
Driven_by_gene | WBGene00001454 | ||
Fusion_reporter | GFP | ||
Construction_summary | C. elegans genomic DNA was used as template. Primers used are: FLP99 GAGTCGTTATTCAGTATGAAC and FLP153 CACACCAGATGATGTGAGTGG. PCR products were digested with HindIII/EcoRV, inserted into vector pCR-Blunt that was digested with HindIII/SmaI. --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00005149 | |
Reference | WBPaper00024197 | ||
WBPaper00044482 |