WormBase Tree Display for Construct: WBCnstr00001621
expand all nodes | collapse all nodes | view schema
WBCnstr00001621 | Summary | [unc-57::gfp] | |
---|---|---|---|
Driven_by_gene | WBGene00006791 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | pKS30 was injected into lin-15(n765ts) worms at a concentration of 25 ng/ul along with EK L15 (60 ng/ul) to generate oxEx481. A 4.5 kb promoter fragment upstream of the T20D1.3 ORF was amplified from the cosmid T04D1 using primers u57ntx1: TAATAGATCCTTCCGATGAATCGG and u57ntx2: GGCATGCTTTTCTGAAAATTTTGAGTTTTAGATTCGG. The resulting 4.5 kb fragment was TA cloned into the pCR2.1 vector (Invitrogen). A SmaI to ApaI fragment containing GFP and the unc-54 termination sequence from pPD95.67 was cloned into the EcoRV and ApaI sites of pCR2.1. --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00001632 | |
Reference | WBPaper00006213 |