Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00001621

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00001621Summary[unc-57::gfp]
Driven_by_geneWBGene00006791
Fusion_reporterGFP
Type_of_constructTranscriptional_fusion
Construction_summarypKS30 was injected into lin-15(n765ts) worms at a concentration of 25 ng/ul along with EK L15 (60 ng/ul) to generate oxEx481. A 4.5 kb promoter fragment upstream of the T20D1.3 ORF was amplified from the cosmid T04D1 using primers u57ntx1: TAATAGATCCTTCCGATGAATCGG and u57ntx2: GGCATGCTTTTCTGAAAATTTTGAGTTTTAGATTCGG. The resulting 4.5 kb fragment was TA cloned into the pCR2.1 vector (Invitrogen). A SmaI to ApaI fragment containing GFP and the unc-54 termination sequence from pPD95.67 was cloned into the EcoRV and ApaI sites of pCR2.1. --precise ends.
Used_forTransgene_constructWBTransgene00001632
ReferenceWBPaper00006213