Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00001618

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00001618Summary[unc-57(+)]
Driven_by_geneWBGene00006791
GeneWBGene00006791
Construction_summaryrescue construct. 2 kb of upstream endophilin promoter sequence was amplified by PCR from genomic DNA using primers of sequence GCGAAGCTTTCCAATTTTTTTCAAATATCCGC and GTCGATACGTTTCTGCAGCATCG and was subcloned into pPD95.81 using HindIII and PstI to form pDR1. The 3 end of the endophilin gene was PCR amplified from N2 genomic DNA using primers of sequence CGCGGATCCTCAAAATTTTCAGAAAAATGTCGTTG and CGCACCGGTTACGGTACCTTAAGAGGCACTAGAACCTGTAC, which contains an AgeI restriction site. pDR1 was injected into unc-57(ok310); lin-15(7765ts) at a concentration of 20 ng/ul along with the co-injection marker Punc-122:GFP (60 ng/ul) to generate oxEx422.
Used_forTransgene_constructWBTransgene00001629
ReferenceWBPaper00006213