WormBase Tree Display for Construct: WBCnstr00001618
expand all nodes | collapse all nodes | view schema
WBCnstr00001618 | Summary | [unc-57(+)] | |
---|---|---|---|
Driven_by_gene | WBGene00006791 | ||
Gene | WBGene00006791 | ||
Construction_summary | rescue construct. 2 kb of upstream endophilin promoter sequence was amplified by PCR from genomic DNA using primers of sequence GCGAAGCTTTCCAATTTTTTTCAAATATCCGC and GTCGATACGTTTCTGCAGCATCG and was subcloned into pPD95.81 using HindIII and PstI to form pDR1. The 3 end of the endophilin gene was PCR amplified from N2 genomic DNA using primers of sequence CGCGGATCCTCAAAATTTTCAGAAAAATGTCGTTG and CGCACCGGTTACGGTACCTTAAGAGGCACTAGAACCTGTAC, which contains an AgeI restriction site. pDR1 was injected into unc-57(ok310); lin-15(7765ts) at a concentration of 20 ng/ul along with the co-injection marker Punc-122:GFP (60 ng/ul) to generate oxEx422. | ||
Used_for | Transgene_construct | WBTransgene00001629 | |
Reference | WBPaper00006213 |