WormBase Tree Display for Antibody: WBAntibody00000758
expand all nodes | collapse all nodes | view schema
| WBAntibody00000758 | Summary | Polyclonal rat antibody against UNC-89 recombinant protein. | ||
|---|---|---|---|---|
| Public_name | [cgc6760]:unc-89_a | |||
| Other_name | EU133 | |||
| anti-IK | ||||
| Gene | WBGene00006820 | |||
| Isolation | Original_publication | WBPaper00024436 | ||
| Location | GB | |||
| Clonality | Polyclonal | |||
| Antigen | Protein | In order to generate antibodies (anti-IK) to the new region of UNC-89, a GST fusion protein with 430 amino acid residues of the sequence lying between the two protein kinase domains and immediately upstream of the last Ig domain was expressed. A 1.3 kb fragment encoding this sequence was amplified from cDNA using Herculase polymerase (Stratagene) with primers GTACGGATCCCCACAAGACAAAGGAGAAACC and GATGCTCGAGCATCATCATTCTTCTTTGTGGC containing added BamHI and XhoI sites and ligated to pGEX-6P-1. | ||
| Animal | Rat | |||
| Reference | WBPaper00005938 | |||
| WBPaper00024436 | ||||
| WBPaper00027703 | ||||
| WBPaper00027070 | ||||
| WBPaper00049445 |
