WormBase Tree Display for Antibody: WBAntibody00000526
expand all nodes | collapse all nodes | view schema
| WBAntibody00000526 | Summary | Rabbit polyclonal antibodies were raised against a GST-MEL-11 fusion protein. The antisera were affinity purified using a cyanogen-bromide-activated Sepharose column coupled to the MEL-11 fragment cleaved from the GST-MEL-11 protein. | ||
|---|---|---|---|---|
| Public_name | [cgc5318]:mel-11 | |||
| Gene | WBGene00003196 | |||
| Isolation | Location | HR | ||
| Clonality | Polyclonal | |||
| Antigen | Protein | A GST-MEL-11 fusion containing 64 amino acids from a portion 3 to the ankyrin repeats (encoded by 192 bp from the start of exon 13, using forward primer 5 CAGGATCCGCAGTCGTCCAACAGAAC 3 and reverse primer 5 GCGAATTCCGGCAACCGATAAAT 3). | ||
| Animal | Rabbit | |||
| Expr_pattern | Expr2739 | |||
| Expr11882 | ||||
| Interactor | WBInteraction000501465 | |||
| WBInteraction000501466 | ||||
| WBInteraction000504550 | ||||
| Reference | WBPaper00005318 | |||
| WBPaper00006149 |
