WormBase Tree Display for Sequence: M162
expand all nodes | collapse all nodes | view schema
| M162 | DNA | M162 | 39978 | ||
|---|---|---|---|---|---|
| SMap | S_child (11) | ||||
| Structure | From | Source | CHROMOSOME_V | ||
| Overlap_right | Y116F11B | 39870 | |||
| Overlap_left | W04E12 | ||||
| DB_info | Database | EMBL | NDB_AC | Z82278 | |
| NDB_SV | Z82278.2 | ||||
| DB_remark | [121025] Sequence correction WBsf268509 : Insertion T1 bases from @ 35179 | ||||
| Keyword | HTG | ||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
| Origin | From_author | Basham VM | |||
| From_laboratory | HX | ||||
| Date_directory | 970511 | ||||
| Species | Caenorhabditis elegans | ||||
| Strain | WBStrain00000001 | ||||
| Visible | Clone | M162 | |||
| Properties | Genomic_canonical | ||||
| Checksum | MD5 | b8a40ed60143d3747a9d30c5f6900b7b | |||
| Status | Finished | 11 May 1997 00:00:00 | |||
| Submitted | 11 Nov 1996 00:00:00 | ||||
| Annotated | 01 Jan 1980 00:00:00 | ||||
| Map | Sequence-V | Ends | Left | 11212 | |
| Right | 11243 | ||||
| Interpolated_map_position | V | 23.3542 | |||
| Assembly_tags | Clone left end | 1 | 4 | ||
| 7870 | 7869 | ||||
| Finished Left | 1 | 4 | |||
| Clone right end | 7870 | 7873 | |||
| 39978 | 39975 | ||||
| annotation | 4209 | 5350 | |||
| 5179 | 5350 | ||||
| 5402 | 5637 | Repeat of 35bp. | |||
| 8674 | 8691 | ||||
| cosmid vector | 1 | 4 | |||
| 4 | 1 | ||||
| 7873 | 7870 | CAF:End=Left::lorist4 | |||
| 39975 | 39978 | CAF:End=Left::PJB8 | |||
| 39978 | 39975 | CAF:End=Left::PJB8 | |||
| oligo | 622 | 641 | serial#= template=vf28g8.r1t sequence=CTAAAGTAGTGGAAAAATGC flags= W04E12.5 | ||
| 1263 | 1244 | serial#= template=vf28g8.s1 sequence=GACAAACAATCAAAATACGC flags= W04E12.4 | |||
| 28038 | 28055 | serial#= sequence=TTTGACCAATAATTGCGG flags= M162.1 | |||
| 28372 | 28373 | ||||
| 28357 | 28372 | M162.3 GACATTTTCTGGGTTCC | |||
| 28650 | 28634 | serial#= template=vi36b7.1.2.s2tb sequence=TTGAAACTAGGGCTGGC flags= M162.5 | |||
| 28503 | 28487 | M162.4 GGTGGCAAATGATGCTG | |||
| 28498 | 28482 | M162.4 GGTGGCAAATGATGCTG | |||
| 28815 | 28799 | serial#= template=vi42b4.s1 sequence=TCGGCAGTTTGAAATCC flags= M162.2 | |||
| comment | 5010 | 5010 | ? | ||
| 5120 | 5120 | Could this be part of some of the missing repeat bases? | |||
| 5702 | 5702 | ? | |||
| 5628 | 5615 | These clones are missing some of the repeat: vf30d9.r1t vf28b7.r1t/.r1ta vf26f12.s1t I have trimmed them back, but left the *'s in to show where they match up before here. | |||
| 8314 | 8324 | Check this edit | |||
| 28386 | 28390 | ?here?? | |||
| 32069 | 32095 | Check the edit here!! | |||
| Direct Repeat | 4209 | 5350 | Repeat of 35 bp for 33 sets. | ||
| 5179 | 5350 | Repeat of 35 bp for 33 sets. Restriction digests suggests that thereis a further 10 copies (350 bp) missing. | |||
| Alu segment | 8676 | 8675 | Some clones read 18 T's and some read 17 T's. Edited to the maximum of 18 T's. | ||
| Finished Right | 39975 | 39978 | |||
| Method | Genomic_canonical |
