WormBase Tree Display for Expr_pattern: Expr4390
expand all nodes | collapse all nodes | view schema
Expr4390 | Expression_of | Gene | WBGene00010284 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00010284 | |||
Expression_data | Life_stage | WBls:0000024 | ||
WBls:0000038 | ||||
WBls:0000027 | ||||
WBls:0000035 | ||||
WBls:0000041 | ||||
Anatomy_term | WBbt:0003681 | Certain | ||
WBbt:0005733 | Certain | |||
WBbt:0005772 | Certain | |||
WBbt:0005829 | Certain | |||
WBbt:0006751 | Certain | |||
Type | Reporter_gene | To test the tissue specificity of the expression of Caenorhabditis mannosidase II, a promoter gfp reporter construct was designed to generate a translational fusion. To select easily for the low copy number transformants carrying the aman-2::gfp reporter fusion, the 2000 bp upstream of the aman-2 gene were ligated into a vector carrying not only a gfp sequence but also the unc-119 gene and stably integrated into unc-119 (ed3) mutants. Two independent low copy number transgenic lines were generated and analyzed. The reporter plasmid used was a form of the pPD95.67 (L2459) promoterless gfp vector3. This vector was then modified by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. Then, a genomic fragment corresponding to the 2000 bp upstream of the aman-2 gene was isolated by PCR using the primers ManII_prom/1/XbaI gctctagacggacgagaagtacaaat and ManII_prom/2/XbaI gctctagacccatgctttatcttgccat. Both the fragment and the pPD95.67/unc-119 vector were cut with XbaI and ligated. A selected clone was sequenced and verified to contain the expected aman-2 upstream region and was used to transform unc-119 (ed3) mutants with a particle gun. --precise ends. | ||
Pattern | Confocal microscopy indicated that the aman-2 promoter is most active in the gut wall, pharynx and grinder, hypodermal cells, and cells of the nervous system (ventral nerve cord cells, neurons surrounding the pharyngeal bulb and in the head) in adult animals; also rather ubiquitous expression was seen in larvae. | |||
Picture | WBPicture0000008308 | |||
Reference | WBPaper00027768 | |||
Transgene | WBTransgene00004947 |