WormBase Tree Display for Expr_pattern: Expr2811
expand all nodes | collapse all nodes | view schema
Expr2811 | Expression_of | Gene | WBGene00001792 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001792 | |||
Expression_data | Anatomy_term | WBbt:0005812 | Certain | |
GO_term | GO:0005737 | |||
Subcellular_localization | cytoplasm | |||
Type | Reporter_gene | |||
Pattern | GST-44::GFP localizes throughout the cytoplasm of the excretory cell. 5'upstream : 5'-cattgttgggcgttgaggtag, 5' nested : 5'ctgaaaaataatttggtttatg, 3' fusion primer: 5'AGTCGACCTGCAGGCATGCAAGCTcaagccataatcaaaatatggc. --precise ends. | |||
Reference | WBPaper00006263 | |||
Transgene | WBTransgene00028190 |