WormBase Tree Display for Variation: WBVar02158814
expand all nodes | collapse all nodes | view schema
| WBVar02158814 | Evidence | Person_evidence | WBPerson1503 | ||
|---|---|---|---|---|---|
| Name | Public_name | fj58 | |||
| Other_name | CE04479:p.Ser40ThrfsTer29 | ||||
| F32E10.6.1:c.118_427del | |||||
| HGVSg | CHROMOSOME_IV:g.7579528_7579925del | ||||
| Sequence_details | SMap | S_parent | Sequence | F32E10 | |
| Flanking_sequences | tctcccacatctccgagtgagacaccgggt | tttgctacgctttgcccggtgtttcgtggc | |||
| Mapping_target | F32E10 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00053675 | ||||
| WBStrain00054542 | |||||
| Laboratory | ZT | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00017993 | |||
| Transcript | F32E10.6.1 (11) | ||||
| Possibly_affects | WBGene00017993 | Paper_evidence | WBPaper00065293 | ||
| Isolation | Mutagen | CRISPR_Cas9 | |||
| Reference | WBPaper00065293 | ||||
| Remark | fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be checked by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. | Person_evidence | WBPerson1503 | ||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson1503 on 2023-05-11_00:33:25 via the Allele submission form. Submitted data refers to CDS located on minus strand. | Curator_confirmed | WBPerson51134 | |||
| [2023-08-02T17:47:42.486Z WBPerson51134] New Variation: Ref: WBPaper00065293, Gene WBGene00017993, Variation information submitted by WBPerson1503 on 2023-05-11_00:33:25 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Method | Engineered_allele |
