WormBase Tree Display for Variation: WBVar02157917
expand all nodes | collapse all nodes | view schema
WBVar02157917 | Evidence | Person_evidence | WBPerson38015 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | raj182 | ||||||
Sequence_details | SMap | S_parent | Sequence | F23H12 | ||||
Flanking_sequences | tcgcaccgttatgattcaatcattcctcaa | tcatcatctcgttgttgtgtatagtcgcgt | ||||||
Mapping_target | F23H12 | |||||||
SeqStatus | Sequenced | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Production_method | CRISPR_Cas9 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003886 | ||||||
WBGene00005018 | ||||||||
Transcript | F23H12.4a.1 | |||||||
Possibly_affects | WBGene00005018 | Paper_evidence | WBPaper00061301 | |||||
Remark | CGC_name sqt-3 | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000501 | Paper_evidence | WBPaper00061301 | ||||
Curator_confirmed | WBPerson38015 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00061301 | |||||
Curator_confirmed | WBPerson38015 | |||||||
Reference | WBPaper00061301 | |||||||
Remark | Variation information submitted by WBPerson38015 on 2022-06-28_10:10:57 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||
TCGCACCGTTATGATTCAATCATTCCTCAA------------------------------------------------GTCCAAACCTCAtcatccctcaaacctcaccaaaccTCATCATCTCGTTGTTGTGTATAGTCGCGT del: - ins: lowercase letters revertant, intragenic suppressor of sqt-3(raj131), isolated using CRISPR-Cas9 parallel genetics approach (Froehlich & Uyar et al., 2021). | Person_evidence | WBPerson38015 | ||||||
[2022-09-29T19:58:19.111Z WBPerson2987] New Variation: WBPaper00061301; Table S3 allele of sqt-3 | Curator_confirmed | WBPerson2987 | ||||||
Method | Engineered_allele |