WormBase Tree Display for Variation: WBVar02157916
expand all nodes | collapse all nodes | view schema
WBVar02157916 | Evidence | Person_evidence | WBPerson38015 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | raj181 | ||||||
Other_name | F23H12.4a.1:c.*134_*136delinsATCCCTCAAACCTCACCAAACC | |||||||
HGVSg | CHROMOSOME_V:g.12354214_12354216delinsATCCCTCAAACCTCACCAAACC | |||||||
Sequence_details | SMap | S_parent | Sequence | F23H12 | ||||
Flanking_sequences | ctttacttctttcttctcacagtccaaacc | tcatcatctcgttgttgtgtatagtcgcgt | ||||||
Mapping_target | F23H12 | |||||||
Type_of_mutation | Insertion | ATCCCTCAAACCTCACCAAACC | ||||||
Deletion | TCA | |||||||
SeqStatus | Sequenced | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Production_method | CRISPR_Cas9 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00005018 | ||||||
Transcript | F23H12.4a.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F23H12.4a.1:c.*134_*136delinsATCCCTCAAACCTCACCAAACC | |||||||
cDNA_position | 1316-1318 | |||||||
Exon_number | 5/5 | |||||||
Possibly_affects | WBGene00005018 | Paper_evidence | WBPaper00061301 | |||||
Remark | CGC_name sqt-3 | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000501 | Paper_evidence | WBPaper00061301 | ||||
Curator_confirmed | WBPerson38015 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00061301 | |||||
Curator_confirmed | WBPerson38015 | |||||||
Reference | WBPaper00061301 | |||||||
Remark | revertant of sqt-3(raj131), isolated using CRISPR-Cas9 parallel genetics approach (Froehlich & Uyar et al., 2021) | Paper_evidence | WBPaper00061301 | |||||
Person_evidence | WBPerson38015 | |||||||
Curator_confirmed | WBPerson51134 | |||||||
alt_det = ATCCCTCAAACCTCACCAAACC | Paper_evidence | WBPaper00061301 | ||||||
Person_evidence | WBPerson38015 | |||||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson38015 on 2022-06-28_09:57:37 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
[2022-09-29T19:58:02.384Z WBPerson2987] New Variation: WBPaper00061301; Table S3 allele of sqt-3 | Curator_confirmed | WBPerson2987 | ||||||
Method | Engineered_allele |