WormBase Tree Display for Variation: WBVar02157255
expand all nodes | collapse all nodes | view schema
| WBVar02157255 | Evidence | Person_evidence | WBPerson282 | ||
|---|---|---|---|---|---|
| Name | Public_name | iw86 | |||
| Other_name (12) | |||||
| HGVSg | CHROMOSOME_III:g.3000994T>A | ||||
| Sequence_details | SMap | S_parent | Sequence | Y55D5A | |
| Flanking_sequences | tcgacgctggatcatctacattaatcttaa | agcacacggtccgaaacgatcacccatcag | |||
| Mapping_target | Y55D5A | ||||
| Type_of_mutation | Substitution | T | A | ||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Status | Live | ||||
| Affects | Gene | WBGene00000898 | |||
| Transcript | Y55D5A.5g.1 (12) | ||||
| Y55D5A.5e.1 (12) | |||||
| Y55D5A.5f.1 (12) | |||||
| Y55D5A.5a.1 (12) | |||||
| Y55D5A.5c.1 (12) | |||||
| Y55D5A.5d.1 (12) | |||||
| Possibly_affects | WBGene00000898 | Paper_evidence | WBPaper00060588 | ||
| Remark | CGC_name daf-2 | ||||
| Isolation | Mutagen | EMS | |||
| Genetics | Interpolated_map_position | III | -8.12396 | ||
| Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00060588 | |
| Curator_confirmed | WBPerson282 | ||||
| WBPhenotype:0000637 | Paper_evidence | WBPaper00060588 | |||
| Curator_confirmed | WBPerson282 | ||||
| Reference | WBPaper00060588 | ||||
| Remark | [2022-03-22T01:12:19.048Z WBPerson2987] New Variation: WBPaper00060588; allele of daf-2; Using Y55D5A.5a transcript predicted to generate a protein of 1,846 amino acids as the reference, the molecular changes are ... iw86 I1281F (ATT to TTT) | Curator_confirmed | WBPerson2987 | ||
| alt_det = A to T mut_det = I1281F Y55D5A.5a | Person_evidence | WBPerson282 | |||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson282 on 2022-03-18_15:21:56 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
| Method | Substitution_allele |
