WormBase Tree Display for Variation: WBVar02156978
expand all nodes | collapse all nodes | view schema
| WBVar02156978 | Evidence | Person_evidence | WBPerson12357 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | pan5 | ||||||
| Other_name | CE05311:p.Ser47Gly | |||||||
| C26C6.2.1:c.139_141delinsGGA | ||||||||
| HGVSg | CHROMOSOME_I:g.7522348_7522350delinsGGA | |||||||
| Sequence_details | SMap | S_parent | Sequence | C26C6 | ||||
| Flanking_sequences | ctgctacttggtgcaggagaatcaggaaaa | actattgtaaaacagatgaagtgagatttt | ||||||
| Mapping_target | C26C6 | |||||||
| Type_of_mutation | Insertion | GGA | ||||||
| Deletion | TCG | |||||||
| SeqStatus | Sequenced | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00049506 | |||||||
| Production_method | CRISPR_Cas9 | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00001648 | ||||||
| Transcript | C26C6.2.1 | VEP_consequence | missense_variant | |||||
| VEP_impact | MODERATE | |||||||
| HGVSc | C26C6.2.1:c.139_141delinsGGA | |||||||
| HGVSp | CE05311:p.Ser47Gly | |||||||
| cDNA_position | 232-235 | |||||||
| CDS_position | 138-141 | |||||||
| Protein_position | 46-47 | |||||||
| Exon_number | 2/10 | |||||||
| Codon_change | aaATCG/aaAGGA | |||||||
| Amino_acid_change | KS/KG | |||||||
| Description | Phenotype | WBPhenotype:0000005 | Paper_evidence | WBPaper00062031 | ||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0000016 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00062031 | ||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0000642 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| Remark | Hyperactive locomotion | Paper_evidence | WBPaper00062031 | |||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| Remark | Increased time spent in a coiled position | Paper_evidence | WBPaper00062031 | |||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0000664 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0000697 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0001701 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| Remark | PTZ hypersensitive | Paper_evidence | WBPaper00062031 | |||||
| Curator_confirmed | WBPerson12357 | |||||||
| Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00062031 | ||||
| Curator_confirmed | WBPerson12357 | |||||||
| WBPhenotype:0002549 | Paper_evidence | WBPaper00062031 | ||||||
| Curator_confirmed | WBPerson12357 | |||||||
| Disease_info | Models_disease | DOID:0112202 | ||||||
| Models_disease_in_annotation | WBDOannot00001098 | |||||||
| WBDOannot00001106 | ||||||||
| Reference | WBPaper00062031 | |||||||
| Remark | Batch Variation object requested via get_NS_ids.pl | |||||||
| The 30 bp flanking sequences correspond to the wild-type sequence flanking the mutated codon. In this region, however, a number of silent mutations has been introduced during the CRISPR-Cas9 process. | Person_evidence | WBPerson12357 | ||||||
| Curator_confirmed | WBPerson51134 | |||||||
| alt_det = c.139_141 TCG>GGA mut_det = p.Ser47Gly | Person_evidence | WBPerson12357 | ||||||
| Curator_confirmed | WBPerson51134 | |||||||
| Variation information submitted by WBPerson12357 on 2021-10-13_09:19:11 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
| Method | Engineered_allele |
