WormBase Tree Display for Variation: WBVar02156779

WBVar02156779 Name: Public_name: gk5953
    Other_name: Y48A6B.3.1:c.37_*6del
    HGVSg: CHROMOSOME_III:g.11008267_11008823del
  Sequence_details: SMap: S_parent: Sequence: Y48A6B
    Flanking_sequences: AAGCGCAATCTGGACGAGACAATGAACGAG TTTTCTCTGGTTTTCACTGTTTTTTTTTTG
    Mapping_target: CHROMOSOME_III
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00052136
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00012964
    Transcript: Y48A6B.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y48A6B.3.1:c.37_*6del
        cDNA_position: 46-507
        CDS_position: 37-?
        Protein_position: 13-?
        Intron_number: 2-3/4
        Exon_number: 2-5/5
  Isolation: Mutagen: CRISPR_Cas9
  Remark: Variation accession generated for Mark Edgley for a set of gk CRISPR alleles.
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced.
  Method: Allele