WormBase Tree Display for Variation: WBVar02156776

WBVar02156776 Name: Public_name: gk5950
    HGVSg: CHROMOSOME_III:g.4468850_4471025del
  Sequence_details: SMap: S_parent: Sequence: F56F3
    Flanking_sequences: TAACTGATGAGACGCAGACATTTACATCCT CGGTGTTGTCTCTTAATGGTTAAGCAATTC
    Mapping_target: CHROMOSOME_III
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00052133
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00010155
      WBGene00014402
    Transcript: F56F3.4.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2-6/7
        Exon_number: 1-8/8
      F56F3.t1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: CRISPR_Cas9
  Remark: Variation accession generated for Mark Edgley for a set of gk CRISPR alleles.
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced.
  Method: Allele