WormBase Tree Display for Variation: WBVar02156642
expand all nodes | collapse all nodes | view schema
WBVar02156642 | Name | Public_name | gk5812 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.7259389_7267062del | ||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | |
Flanking_sequences | AAAGATGATGGACAGGAGGAAGAAAATCGA | GGGACGGATAATAGTTTGGCACACACAAGA | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051410 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00002348 | |||
WBGene00200672 | |||||
Transcript | R06C7.10.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-6014 | ||||
Intron_number | 2-9/10 | ||||
Exon_number | 1-11/11 | ||||
R06C7.12 | VEP_consequence | transcript_ablation | |||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Allele |