WormBase Tree Display for Variation: WBVar02156381
expand all nodes | collapse all nodes | view schema
WBVar02156381 | Name | Public_name | gk5482 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.13437086_13439553del | ||||
Sequence_details | SMap | S_parent | Sequence | F45G2 | |
Flanking_sequences | TTTTAAACACGTTTTTATTCGAAACCTGAT | GCTGGAAATGGAAAATGACGAAAAAATATC | |||
Mapping_target | CHROMOSOME_III | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051153 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00009736 | |||
Transcript | F45G2.10.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-553 | ||||
Intron_number | 2-4/5 | ||||
Exon_number | 1-6/6 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Allele |