WormBase Tree Display for Variation: WBVar02156373
expand all nodes | collapse all nodes | view schema
WBVar02156373 | Name | Public_name | gk5444 | ||
---|---|---|---|---|---|
Other_name | CE04242:p.Ala5_Ter307delextTer? | ||||
C50F7.4.1:c.13_921del | |||||
HGVSg | CHROMOSOME_IV:g.7728932_7730144del | ||||
Sequence_details | SMap | S_parent | Sequence | C50F7 | |
Flanking_sequences | GGATTTTTAAGATTAATAATGCTTCGTGCT | GGAGGTGAACCAGCAAACTTCCTCGACGTC | |||
Mapping_target | CHROMOSOME_IV | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051146 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00016844 | |||
Transcript | C50F7.4.1 (11) | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Allele |