WormBase Tree Display for Variation: WBVar02154293
expand all nodes | collapse all nodes | view schema
| WBVar02154293 | Evidence | Curator_confirmed | WBPerson1983 | |
|---|---|---|---|---|
| Name | Public_name | veDf2 | ||
| Sequence_details | Flanking_sequences | tcagagcatagacgacgtccatagcagtta | cctaattgagttgttccaataaaattttca | |
| Mapping_target | C26B2 | |||
| Type_of_mutation | Deletion | |||
| SeqStatus | Sequenced | |||
| Variation_type | Engineered_allele | |||
| Origin | Species | Caenorhabditis elegans | ||
| Strain | WBStrain00049460 | |||
| Production_method | CRISPR_Cas9 | |||
| Status | Live | |||
| Affects | Gene | WBGene00001905 | ||
| WBGene00001906 | ||||
| WBGene00001907 | ||||
| WBGene00001908 | ||||
| Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | |||
| Allele Description:veDf2 IV. | ||||
| sgRNA1:CGAGCACGCCAAGAGAAAGA sgRNA2: TCTTTCAGAACAACATCTCA | ||||
| Method | Engineered_allele |
