WormBase Tree Display for Variation: WBVar02154007
expand all nodes | collapse all nodes | view schema
WBVar02154007 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | ve559 | |||
HGVSg | CHROMOSOME_V:g.5111630_5113885del | ||||
Sequence_details | SMap | S_parent | Sequence | C04F5 | |
Flanking_sequences | ccgagtccccgtgagctctcgaatcccgta | atgggttactgtagcgcttgtatcgattta | |||
Mapping_target | C04F5 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Allele | |||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047465 | ||||
Laboratory | RG | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00015450 | |||
Transcript | C04F5.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-989 | ||||
CDS_position | ?-988 | ||||
Protein_position | ?-330 | ||||
Intron_number | 2-4/5 | ||||
Exon_number | 1-5/6 | ||||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | |||||
Allele Description:C04F5.8(ve559[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | |||||
Method | Engineered_allele |