WormBase Tree Display for Variation: WBVar02153934
expand all nodes | collapse all nodes | view schema
WBVar02153934 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | umn3 | |||
Other_name | F13D2.1a.1:c.813+880_813+1883del | ||||
F13D2.1b.1:c.813+880_813+1883del | |||||
HGVSg | CHROMOSOME_X:g.11185763_11186766del | ||||
Sequence_details | SMap | S_parent | Sequence | F13D2 | |
Flanking_sequences | ttgttctggtttaaagccgcaaagtcttgg | agggtaccatcaagcaatggcattctggtt | |||
Mapping_target | F13D2 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Allele | |||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004989 | ||||
Laboratory | CGC | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00008735 | |||
WBGene00008737 | |||||
Transcript | F13D2.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-646 | ||||
CDS_position | ?-632 | ||||
Protein_position | ?-211 | ||||
Intron_number | 2-4/8 | ||||
Exon_number | 1-5/9 | ||||
F13D2.1b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F13D2.1b.1:c.813+880_813+1883del | ||||
Intron_number | 9/38 | ||||
F13D2.1a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F13D2.1a.1:c.813+880_813+1883del | ||||
Intron_number | 8/37 | ||||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | |||||
Allele Description:gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | |||||
Method | Engineered_allele |