WormBase Tree Display for Variation: WBVar02153734
expand all nodes | collapse all nodes | view schema
WBVar02153734 | Name | Public_name | gk5480 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.13309660_13310568del | ||||
Sequence_details | SMap | S_parent | Sequence | T04D3 | |
Flanking_sequences | GACGAAAAATCCAAATACATAACGAGACCC | GATGGACTCAATTTCGACTATTTCCTGTTC | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047661 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00014503 | |||
WBGene00011435 | |||||
Transcript | T04D3.t4 | VEP_consequence | transcript_ablation | ||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
T04D3.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-288 | ||||
CDS_position | ?-268 | ||||
Protein_position | ?-90 | ||||
Intron_number | 2-3/4 | ||||
Exon_number | 1-4/5 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | I | 17.6189 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Deletion_allele |