WormBase Tree Display for Variation: WBVar02153718
expand all nodes | collapse all nodes | view schema
WBVar02153718 | Name | Public_name | gk5448 | ||
---|---|---|---|---|---|
Other_name | T12A2.1.1:c.852+3772_852+4934del | ||||
C18F10.4.1:c.9_*18del | |||||
HGVSg | CHROMOSOME_III:g.6257192_6258354del | ||||
Sequence_details | SMap | S_parent | Sequence | C18F10 | |
Flanking_sequences | TTGCCGAAGTAAAAAAAACAGTTGACGAAA | ATCGGCATTCGGTATTCAGCTTCAATTTTT | |||
Mapping_target | CHROMOSOME_III | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047642 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00005159 | |||
WBGene00020436 | |||||
Transcript | C18F10.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | C18F10.4.1:c.9_*18del | ||||
cDNA_position | 9-885 | ||||
CDS_position | 9-? | ||||
Protein_position | 3-? | ||||
Intron_number | 1-4/5 | ||||
Exon_number | 1-6/6 | ||||
T12A2.1.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T12A2.1.1:c.852+3772_852+4934del | ||||
Intron_number | 7/10 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | III | -1.40744 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Deletion_allele |