WormBase Tree Display for Variation: WBVar02153634
expand all nodes | collapse all nodes | view schema
WBVar02153634 | Name | Public_name | gk5152 | ||
---|---|---|---|---|---|
Other_name | W02D3.5.1:c.22_391del | ||||
CE14426:p.Arg8SerfsTer? | |||||
HGVSg | CHROMOSOME_I:g.6728422_6729345del | ||||
Sequence_details | SMap | S_parent | Sequence | W02D3 | |
Flanking_sequences | GGGAATTGAGAATCTATTCGCGAACGTACT | TCCAACGAATTCTTGAGACATGGTGATGGT | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037907 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00002258 | |||
Transcript | W02D3.5.1 (11) | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | I | 1.30001 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
Method | Deletion_allele |