WormBase Tree Display for Variation: WBVar02152745

WBVar02152745 Name: Public_name: tm12506
    HGVSg: CHROMOSOME_V:g.12002120_12002225del
  Sequence_details: SMap: S_parent: Sequence: F57F5
    Flanking_sequences: cagagacacagcatagacggagagagtcta tgccaaggtcgccagttcgagcctggcatg
    Mapping_target: F57F5
    Source_location: 7 CHROMOSOME_V 12002119 12002226 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm12506_external
      tm12506_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12506
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00200204
      WBGene00014406
    Transcript: F57F5.7 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: 56-?
        Exon_number: 1/1
      F57F5.t1 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-39
        Intron_number: 1/1
        Exon_number: 1-2/2
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 5144/5145-5250/5251(106 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele