WormBase Tree Display for Variation: WBVar02152197

WBVar02152197 Name: Public_name: tm11897
    Other_name: T27F2.8:n.2426_2513delinsGTGAG
    HGVSg: CHROMOSOME_V:g.11641339_11641426delinsCTCAC
  Sequence_details: SMap: S_parent: Sequence: T27F2
    Flanking_sequences: gaaaaataagacgcaaaagcgtcttcttct acagctccaatgtgtgtgtgtgtgtgaaaa
    Mapping_target: T27F2
    Source_location: 7 CHROMOSOME_V 11641338 11641427 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CTCAC
      Deletion
    PCR_product: tm11897_external
      tm11897_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11897
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00219612
    Transcript: T27F2.8 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: T27F2.8:n.2426_2513delinsGTGAG
        cDNA_position: 2426-2513
        Exon_number: 2/2
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 8253/8254-CTCAC-8341/8342(88 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele