WormBase Tree Display for Variation: WBVar02152128

WBVar02152128 Name: Public_name: tm11824
    Other_name: F11G11.5.1:c.576_*31delinsT
    HGVSg: CHROMOSOME_II:g.4858751_4858878delinsT
  Sequence_details: SMap: S_parent: Sequence: F11G11
    Flanking_sequences: tgatatgtgctgtcttctatgtctgattat tagtattattatttcccccttcctaccaag
    Mapping_target: F11G11
    Source_location: 7 CHROMOSOME_II 4858750 4858879 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm11824_external
      tm11824_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11824
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017385
    Transcript: F11G11.5.1 VEP_consequence: stop_lost,3_prime_UTR_variant
        VEP_impact: HIGH
        HGVSc: F11G11.5.1:c.576_*31delinsT
        cDNA_position: 586-713
        CDS_position: 576-?
        Protein_position: 192-?
        Exon_number: 5-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Remark: 8439/8440-T-8567/8568(128 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele