WormBase Tree Display for Variation: WBVar02151808
expand all nodes | collapse all nodes | view schema
WBVar02151808 | Name | Public_name | tm11476 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.2312099_2320706del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01B6 | ||||
Flanking_sequences | tcaagcccggcctcaccccctagaatcatt | tgttattgagcgtttttgttatcagggaga | ||||||
Mapping_target | T01B6 | |||||||
Source_location | 7 | CHROMOSOME_X | 2312098 | 2320707 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11476_external | |||||||
tm11476_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11476 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects (2) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Remark | [T10H10]34997/34998-[T01B6]11691/11692 (8608 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target T10H10 updated based on the VEP analysis pipeline to T01B6. | ||||||||
Method | NBP_knockout_allele |