WormBase Tree Display for Variation: WBVar02151701

WBVar02151701 Name: Public_name: tm11366
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_X
    Flanking_sequences: tggtatcgcccgacacgtacggggtccgcg atagtagtaacaaacaaaggagtaaaattt
    Mapping_target: CHROMOSOME_X
    Source_location: 7 CHROMOSOME_X 14734063 14771782 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11366_external
      tm11366_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11366
    NBP_allele
    Status: Live
  Affects: Gene (12)
    Transcript (18)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Remark: [C05G5]2253/2254-[Y16B4A]806/807 (37718 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target C05G5 updated based on the VEP analysis pipeline to CHROMOSOME_X.
  Method: NBP_knockout_allele