WormBase Tree Display for Variation: WBVar02151658
expand all nodes | collapse all nodes | view schema
WBVar02151658 | Name | Public_name | tm11320 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | T09A12 | ||||
Flanking_sequences | aagagaaaaatggttaaattcagtgagcag | gattgaaagtatgtttagtttttaggctag | ||||||
Mapping_target | T09A12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 8213915 | 8238974 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11320_external | |||||||
tm11320_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11320 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020373 | ||||||
WBGene00200918 | ||||||||
WBGene00219729 | ||||||||
WBGene00003839 | ||||||||
WBGene00003656 | ||||||||
WBGene00020374 | ||||||||
Transcript (16) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Remark | 0036/20037-25094/25095 (5058 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |