WormBase Tree Display for Variation: WBVar02151621

WBVar02151621 Name: Public_name: tm11281
  Sequence_details: SMap: S_parent: Sequence: Y51H4A
    Flanking_sequences: gtttgccgaactaggccattttggctcgcc gaaaattacaaaccaagaggctaactgaaa
    Mapping_target: Y51H4A
    Source_location: 7 CHROMOSOME_IV 16687752 16739849 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11281_external
      tm11281_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11281
    NBP_allele
    Status: Live
  Affects: Gene (191)
    Transcript (194)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 215917/215918-268013/268014 (52096 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele