WormBase Tree Display for Variation: WBVar02151606

WBVar02151606 Name: Public_name: tm11266
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_X
    Flanking_sequences: cagatttaaattatatcggttttctgtaaa gtgacaatatgttgtcgactaaaggaatcc
    Mapping_target: CHROMOSOME_X
    Source_location: 7 CHROMOSOME_X 1363152 1401482 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATCAATCTAC
      Deletion
    PCR_product: tm11266_external
      tm11266_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11266
    NBP_allele
    Status: Live
  Affects: Gene (14)
    Transcript (13)
    Pseudogene: F56C3.5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Remark: [F56C3]6988/6989-ATCAATCTAC-[ZK402]4439/4440 (38329 bp deletion + 10 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F56C3 updated based on the VEP analysis pipeline to CHROMOSOME_X.
  Method: NBP_knockout_allele