WormBase Tree Display for Variation: WBVar02151539

WBVar02151539 Name: Public_name: tm11197
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_V
    Flanking_sequences: atcattgccgaaaaaatgattctaaaaata catctacacagacagaaagtttctatatat
    Mapping_target: CHROMOSOME_V
    Source_location: 7 CHROMOSOME_V 15792979 15822336 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11197_external
      tm11197_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11197
    NBP_allele
    Status: Live
  Affects: Gene (20)
    Transcript (19)
    Pseudogene: F54B8.17
      F54B8.14
      T26E4.13
      T26E4.11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: [T26E4]17848/17849-[F54B8]11824/11825 (29356 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target T26E4 updated based on the VEP analysis pipeline to CHROMOSOME_V.
  Method: NBP_knockout_allele