WormBase Tree Display for Variation: WBVar02151529

WBVar02151529 Name: Public_name: tm11186
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: atattagaatatgaagctgccacggagctt gtcctctgcatttgtccaacaactggttgt
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 4640960 4663656 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11186_external
      tm11186_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11186
    NBP_allele
    Status: Live
  Affects: Gene (11)
    Transcript (21)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Remark: [Y119C1A]381/382-[B0041]20518/20519 (22695 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y119C1A updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele