WormBase Tree Display for Variation: WBVar02151527
expand all nodes | collapse all nodes | view schema
WBVar02151527 | Name | Public_name | tm11184 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | ||||
Flanking_sequences | gagcatccaaatgtaagtaagatttcttga | actgggtagaacattgagagttcgatcaag | ||||||
Mapping_target | CHROMOSOME_I | |||||||
Source_location | 7 | CHROMOSOME_I | 13060119 | 13116095 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11184_external | |||||||
tm11184_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11184 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene (25) | |||||||
Transcript (21) | ||||||||
Pseudogene | Y26D4A.19a | |||||||
Y26D4A.22b | ||||||||
Y26D4A.19b | ||||||||
Y26D4A.22a | ||||||||
Y26D4A.18a | ||||||||
Y26D4A.15 | ||||||||
Y26D4A.18b | ||||||||
Y26D4A.16 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Remark | [Y26D4A]1135/1136-[C17H1]13834/13835 (55975 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target Y26D4A updated based on the VEP analysis pipeline to CHROMOSOME_I. | ||||||||
Method | NBP_knockout_allele |