WormBase Tree Display for Variation: WBVar02151471
expand all nodes | collapse all nodes | view schema
WBVar02151471 | Name | Public_name | tm11122 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.2551875_2558539del | |||||||
Sequence_details | SMap | S_parent | Sequence | F52H2 | ||||
Flanking_sequences | tcgaaacaaaatctctcaaaaaattcaaac | tatttttcgaaaagtttcactaaaaactca | ||||||
Mapping_target | F52H2 | |||||||
Source_location | 7 | CHROMOSOME_X | 2551874 | 2558540 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11122_external | |||||||
tm11122_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11122 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018717 | ||||||
WBGene00198978 | ||||||||
WBGene00000004 | ||||||||
WBGene00198194 | ||||||||
WBGene00023063 | ||||||||
WBGene00201859 | ||||||||
WBGene00196510 | ||||||||
Transcript | F52H2.2a.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-11/12 | |||||||
Exon_number | 1-13/13 | |||||||
F52H2.t1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F52H2.5.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 5/6 | |||||||
Exon_number | 6-7/7 | |||||||
F52H2.11 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F52H2.2b.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-12/13 | |||||||
Exon_number | 1-14/14 | |||||||
F52H2.5.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 6/7 | |||||||
Exon_number | 7-8/8 | |||||||
F52H2.9 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F52H2.12 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F52H2.14 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Remark | 18209/18210-24874/24875 (6665 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |